Inhibition of the TEF/TEAD transcription factor activity by nuclear calcium and distinct kinase pathways
Abstract
Transcription enhancer factor (TEF/TEAD) is a family of four transcription factors that share a common TEA-DNA binding domain and are involved in similar cellular functions, such as cell differentiation and proliferation. All adult tissues express at least one of the four TEAD genes, so this family of transcription factors may be of widespread importance, yet little is known about their regulation. Here we examine the factors that regulate TEAD activity in CHO cells. RT-PCR indicated the presence of TEAD-1, TEAD-3, and both isoforms of TEAD-4, but not TEAD-2. Quantitative measurements showed that TEAD-4 is most abundant, followed by TEAD-3, then TEAD-1. We examined the relative effects of nuclear and cytosolic Ca2þ on TEAD activity, since TEAD proteins are localized to the nucleus and since free Ca2þ within the nucleus selectively regulates transcription in some systems.
Chelation of nuclear but not cytosolic Ca2þ increased TEAD activity two times above control. Inhibition of mitogen-activated protein kinase (MAPK) also increased TEAD activity, while cAMP decreased TEAD activity, and protein kinase C had no effect. Together, these results show that nuclear Ca2þ, MAPK, and cAMP each negatively regulate the activity of the TEAD transcription factor.
Keywords: TEAD; Nuclear calcium; Cytosolic calcium; Kinases
Mammalian tissues as wells as birds, yeast, flies, and fungi express four ubiquitous and highly conserved TEAD/TEF of transcription factors [1–3]. These factors are known to bind with identical affinity to the same DNA sequence, M-CAT motif (50-TCATTCCT-30), and to play a variety of functions during development and cell differentiation [3]. The TEAD-2 gene is the only one of this family to be expressed at the beginning of de- velopment, and its expression matches with the appearance of TEAD transcription factor activity in the cells [2,4,5]. TEAD-1 is required for gene expression in cardiac muscle [6], while TEAD-4 seems to play a role in activating skeletal muscle genes [7], and is highly ex- pressed in lung as well [5]. TEAD-3 on the other hand is primarily expressed in placenta, even though it is present to a lesser extent in cardiac muscle, lung, kidney, and intestine [5]. A variety of tissues express at least one TEAD family member. Since TEAD proteins may be involved in both activation and repression of different genes, they are not considered functionally redundant. It is believed that the specificity of TEAD activity may be related to association with other proteins that can modify their activity. Several cofactors for TEAD pro- teins have been reported. Tondu is a mammalian ho- molog of the Drosophila vestigial gene that binds to all four TEAD proteins and therefore is thought to be a general TEAD transcription cofactor [8]. Max is also thought to be a TEAD cofactor, since TEAD-1 stimu- lates the cardiac a-myosin heavy-chain gene promoter, but only when it is bound to Max [9]. TEAD proteins are concentrated in the cell nucleus, while a newly identified TEAD cofactor, YAP65, is in the cytosol [10].
YAP65 must be transported into the nucleus to bind to TEAD, indicating the presence of sophisticated ma- chinery to regulate TEAD activity. TEAD proteins also may be affected by activation of specific signal trans- duction cascades. For example, TEAD-1 is a substrate for protein kinase-A (PKA)-dependent phosphorylation at a serine residue-102, which results in repression of TEAD-1 DNA binding affinity [9]. Increases in intra- cellular free Ca2þ are involved in translocation and activation of a variety of proteins, but whether Ca2þ plays any role in regulating TEAD activity remains a ques- tion. The general importance of cytoplasmic Ca2þ as a second messenger is well established, but increases in free cytosolic Ca2þ are often accompanied by changes in free nuclear Ca2þ [11,12]. Moreover, increases in nuclear Ca2þ serve a distinct role in the regulation of tran- scription [13–17]. Here, we examined the relative effects of nuclear and cytosolic Ca2þ plus related signaling pathways on the activation of TEAD.
Materials and methods
Material. Chinese hamster ovary tumor (CHO) cells and mouse embryonic (NIH-3T3) cells were purchased from American Type Cul- ture Collection (Rockville, MD). CHO-AT1 (CHO cells stably trans- fected with angiotensin AT1 receptor) was donated by R.S.A. Santos (Federal University of Minas Gerais, MG, Brazil). Dulbecco’s modified Eagle’s medium (DMEM), RPMI, penicillin and streptomycin, fetal bovine serum (FBS), and Trizol were from Gibco (Grand Island, NY). The plasmid pCMV-cyto-GFP (pGFP) was obtained from Invitrogen (Carlsbad, CA), while pRSV-bGalactosidase (pRSV-bGal) was from Promega (Madison, WI). The plasmids pCMV-PV-NLS-GFP (pPV- NLS-GFP), pCMV-PV-NES-GFP (pPV-NES-GFP), and pCMV-PV-NLS-CD-GFP (pPV-NLS-CD-GFP) were generated as described previously [17]. And the plasmid pF101TK-Luc was donated by M.L. DePamphilis (National Institute of Child Health and Human Devel- opment, NIH, Bethesda, MD). Effectene transfection kits were obtained from Qiagen (Valencia, CA), luciferase assay kits were from Promega (Madison, WI), the Ca2þ dye Rhod-2/AM was from Molecular Probes (Eugene, OR), and salmon sperm DNA was from Strategene (Cedar Creek, TX). The drugs phorbol-ester, PD98059, H-89, H-8, and 8-Br- cAMP were purchased from RBI (Natick, MA).
Cell culture and transfection. CHO and NIH-3T3 cells were cultured in RPMI and DMEM, respectively, containing 10% FBS, 50 U/ml penicillin, and 50 lg/ml streptomycin, at 37 °C in 5% CO2. Cells were transfected either by the liposome technique or by electroporation. For the liposome technique, 5 × 105 cells plated in a T25 tissue culture flask were transfected with 0.5 lg of each plasmid, following the manufac- turer’s instructions. One of the plasmids expressed the firefly luciferase reporter gene, driven by a TEAD-dependent enhancer binding domain, called GTIIC and represented by 50gtggaatgt30 (pF101TK-Luc). An- other plasmid expressed the Escherichia coli b-galactosidase gene driven by the RSV promoter (pRSV-bGal). When indicated, 0.5 lg plasmid, pGFP, pPV-NLS-GFP, pPV-NLS-CD-GFP, or pPV-NES-GFP was
included in the transfection. These plasmids contain rat parvalbumin cDNA (PV), or the mutant PV (CD) fused to a targeting signal nuclear localization sequence (NLS) or nuclear export sequence (NES) plus green fluorescent protein (GFP) [17]. For electroporation, 1 × 106 cells (in 0.25 ml tissue culture medium) were mixed with 5 lg plasmid, 2 mg/ ml BES, and 0.2 mg/ml salmon sperm DNA. The cells were subjected to 950 lF shock, with 200 V for 40 ms in a 0.4 cm cuvette using a Bio-Rad Gene Pulser II (San Diego, CA). Afterward cells were transferred to a tissue culture flask containing 5 ml complete culture medium. Cells were incubated for 2–3 days after transfection until cell extracts were prepared for assays.
Luciferase reporter assays. Confluent cells were washed twice with phosphate-buffered saline (PBS) and harvested at 4 °C using 0.5 ml of 1× Reporter Lysis buffer (Promega, Madison, WI), containing 20 lg/ml leupeptin, 10 lM AEBSF, and 0.5 lg/ml aprotinin, after three freeze/ thaw cycles. Cell lysates were scraped and the suspension was centri- fuged at 6000g for 5 min. The resultant supernatant was designated as the cell extract. The extracts were assayed for luciferase activity using a model 1251 luminometer (Wallac, Gaithersburg, MD), using a lucifer-
ase reporter gene assay (Promega, Madison, WI), as described by the manufacturer. The b-galactosidase assay was performed using O-nitro- phenyl galactose as substrate [17,18]. Luciferase activities were nor- malized against the b-galactosidase activities to correct for transfection efficiency. Each transfection was repeated at least 12 times (four times in triplicate). The data were normalized to control conditions and repre- sented as means standard error of the mean (SEM).
Reverse transcription (RT) and PCR amplification. Total RNA from CHO cells was isolated using Trizol reagent. First strand cDNA was synthesized using the primer oligo-(dT)16 and Moloney-murine- leukemia-virus reverse transcriptase. RNA samples were then sub- jected to DNAse and RNAse free treatment to extract any possible genomic DNA. A negative control was carried out, in which RNA but no reverse transcriptase was added (RNA control). The primers used for TEAD amplification were as follows: TEAD1s AGAGCCCTGCC GAAAACATGGAAA, TEAD1a TGGCTGTCCTGTCTGTATCA TC, TEAD2s CCGACATTGAGCAGAGTTTTCAGG, TEAD2a CTTCACGTCTGGAACATTCCATGG, TEAD3s TGGACAAGGGTCTGGACAACGAT, TEAD3a AACCTTGAGGAGGAGGAGAA GACA, TEAD4s ATTACCTCCAACGAGTGGAGCT 30, and TE AD4a CTGGCAAAGCTCCTTGCCAAAA. These primers were used
to amplify bands of 472, 397, 320, 486, and 357 bp from TEAD-1, TEAD-2, TEAD-3, TEAD-4a, and TEAD-4b, respectively [2]. PCR amplification was performed in a PTC-100 automated thermocycler (MJ Research, Watermown, MA) using 2 ll of the first-strand cDNA reaction, 200 nM each primer, 200 lM dNTPs, 2.5 mM MgCl2, and 2.5 U AmpliTaq DNA polymerase for a total volume of 100 ll. The PCR samples were subjected to hot start (2 min at 94 °C), followed by 30 cycles of 45 s at 94 °C, 1 min at 53 °C for TEAD-1, or 59 °C TEAD- 2, or 59 °C TEAD-3, or 57 °C TEAD-4, and 1 min at 72 °C. The re- action was followed by a final extension at 72 °C for 10 min and the PCR product was analyzed by agarose–gel electrophoresis. For semi- quantitative PCR, the reaction was done as described above, but with cycles of 15, 20, 25, and 30. The PCR products were electrophoretically size fractionated in polyacrylamide gel and visualized using silver staining.
Calcium measurements. CHO cells stably transfected with the an- giotensin AT1 receptor subtype, CHO-AT1, were transfected with pGFP, pPV-NLS-GFP, or pPV-NES-GFP, using the transfection techniques described above. For these experiments, cells were plated onto glass coverslips and time-lapse confocal imaging was performed 48 h after transfection as described previously [17,19,20]. Briefly, cells were loaded with 6 lM rhod-2/AM in RPMI/10% FBS for 35 min at 37 °C [17]. A Bio-Rad MRC-1024 was used to acquire the images. Cells were first excited with the 488 nm line of a krypton/argon laser to detect cells with GFP fluorescence and then with the 568 nm line to monitor rhod-2 fluorescence. Cells were observed using a 20×, 0.75 NA objective (zoom factor ¼ 5). Neither autofluorescence nor other
background signals were detected at the machine settings used and there was no change in shape, size, or location of cells during the experiments.
Statistical analysis. Statistical analyses were performed with the PRISM statistical software program (GraphPad, San Diego, CA). Data are given as mean values SE. Groups of data were compared using one-way ANOVA. A p-value of < 0:05 was considered to indi- cate statistically significant differences. Results TEAD activity in CHO cells TEAD activity in CHO and NIH-3T3 cells was compared, since the latter are known to express this transcription factor. CHO cells were co-transfected with pF101TK-Luc and pRSV-bGal, and then lysed and as- sayed for luciferase and galactosidase activities 48 h la- ter. The plasmid pRSV-bGal was included to correct for variations in the transcription efficiency. Both CHO and NIH-3T3 cells displayed TEAD activity, but luciferase activity was approximately five times higher in CHO cells (Fig. 1). Having observed TEAD activity in CHO cells we investigated which isoform is present in this cell type. Total RNA from CHO cells was isolated and cDNA was synthesized for PCR using specific primers for each of the four TEAD isoforms. TEAD transcrip- tion factors are highly homologous among species. For instance, mouse TEAD-1 (mTEAD) and human TEAD (hTEAD) are 99% identical [21]. Therefore, primers based on mTEAD sequences were used for PCR. For positive controls, cloned cDNA of each mTEAD iso- form was used as a template for the respective reaction. Under this experimental condition, a band of 472 bp was observed for TEAD-1 and a band of 320 bp for TEAD-3 (Fig. 2A). In both cases the PCR products co-migrated with the respective positive control. More interesting, the 2 subtypes of TEAD-4 of 486 bp and 357 bp were detected in CHO cells, while only the 486 bp band was amplified using mTEAD-4a cDNA as a template (po- sitive control). TEAD-2 on the other hand failed to be amplified. Semi-quantitative PCR showed that TEAD-4 is most highly expressed followed by TEAD-3 and then TEAD-1 (Fig. 2B). A second band for TEAD-1 was visualized when silver instead of ethidium bromide staining was used, probably due to higher sensitivity of the former methodology. Together, these data confirm that three isoforms of TEAD are expressed in CHO cells and that TEAD-4 is the predominant isoform at the RNA level. Fig. 1. Comparison of TEAD activity in CHO and NIH-3T3 cells. CHO and NIH-3T3 cells were transfected by electroporation with pF101TK-Luc, which contains a TEAD binding domain, followed by a firefly luciferase reporter gene, and pRSV-bGal to correct for vari- ations in transcription efficiency. Cells were lysed 48 h after transfec- tion and the luciferase and b-galactosidase activities were determined. Results in RLU are normalized by galactosidase values. The data are expressed as means SE from triplicate measurements and are repre- sentative of four different experiments. Asterisk indicates a significant difference (p < 0:05) compared to NIH-3T3 cells. Fig. 2. Identification of TEAD isoforms in CHO cells. (A) RT-PCR detection of TEAD isoforms. Total RNA from CHO cells was ex- tracted with Trizol reagent and first-strand cDNA was synthesized using the primer oligo-(dT)16 and Moloney-murine-leukemia-virus reverse transcriptase. Using isoform-specific primers, a single band of 472 bp was identified for TEAD-1 and a band of 320 bp for TEAD-3, while 2 bands of 486 and 357 bp were seen for TEAD-4, indicating TEAD-4a and TEAD-4b subtypes (line 1). As positive control, mTEAD-1, mTEAD-2, mTEAD-3, and mTEAD-4a cDNAs were used for template in each PCR (line 2). No bands were observed in the negative controls (RNA control, line 3). Additionally, a b-actin band of 300 bp was observed for CHO cDNA and no bands in the negative controls, DNA and RNA controls (lines 2 and 3, respectively), indi- cating no contamination. (B) Semi-quantitative PCR. Total RNA was extracted from CHO cells and processed by RT-PCR with the PCRs stopped at the indicated number of cycles: 15, 20, 25, and 30. PCR products were size fractionated in a polyacrylamide gel and visualized using silver staining. Differential regulation of TEAD activity by nuclear and cytoplasmic calcium Parvalbumin (PV) is an intracellular Ca2þ binding protein expressed primarily in muscle and neurons [22,23], and known to inhibit cellular Ca2þ signals [24,25]. We used plasmid constructs to target PV either to the nucleus or to the cytosol, in order to selectively inhibit Ca2þ signaling in these sub-cellular compartments [17]. The differential cellular localization of PV was demonstrated directly by linking green fluorescent pro- tein (GFP) to the plasmid. PV-NLS-GFP and PV-NES- GFP expression plasmids were transiently transfected into CHO cells and confocal images confirmed PV confined to the nucleus or cytosol, respectively (Fig. 3, panel A). In contrast, GFP expressed alone was distrib- uted throughout transfected cells (data not shown). In order to investigate whether PV selectively buffers Ca2þ in specific compartments, we evaluated sub-cellular Ca2þ signaling in CHO-AT1 cells expressing PV-NLS-GFP or PV-NES-GFP. Forty-eight hours after transfection, cells were loaded with the Ca2þ dye, rhod-2/AM. Rhod-2/AM was used rather than lower wavelength Ca2þ dyes in order to avoid bleaching through the GFP channel. Angiotensin-II (10 lM) increased rhod-2 fluorescence in the nucleus of PV-NES-GFP expressing cells, similar to what was observed in non-transfected control cells (Figs. 3B and C). However, expression of PV-NES-GFP sup- pressed increases in rhod-2 fluorescence in the cytosol (Fig. 3B). In non-transfected cells, cytosolic rhod-2 flu- orescence increased upon angiotensin-II treatment (Fig. 3C). The expression of PV-NLS-GFP in CHO-AT1 cells suppressed increases in fluorescence in the nucleus, but did not affect the rise in cytosolic Ca2þ, while the expression of GFP alone had no effect on rhod-2 fluorescence either in the nucleus or cytosol (data not shown). Together, these results demonstrate that the PV con- structs are able to selectively suppress Ca2þ signals in targeted sub-cellular regions in CHO cells, similar to what has been demonstrated in liver cell lines [17]. Nuclear Ca2þ can regulate transcription related to CREB [26] and Elk-1 [17], but the role of either cytosolic or nuclear Ca2þ in TEAD activity is unknown. Therefore, we investigated whether local changes in either nuclear or cytosolic Ca2þ modulate TEAD activation. CHO cells were transiently transfected with pF101TK-Luc and pRSV-bGal, plus either vector, pPV-NLS-GFP, pPV- NES-GFP, or pGFP. pPV-NLS-CD-GFP was used as an additional negative control, since it is a nuclear-targeted PV mutant in which Ca2þ binding is impaired [17]. Forty- eight hours after transfection cells were lysed and changes in the gene reporter activity were evaluated. Expression of PV-NLS-GFP induced TEAD activity 1:97 0:38 times control (GFP alone; Fig. 4). On the other hand, expression of PV-NES-GFP did not affect TEAD activation. Additionally, TEAD activity was not signifi- cantly altered when the cells were co-transfected with pPV-NLS-CD-GFP. Together, these findings show that buffering nuclear Ca2þ increases TEAD activity,suggesting that nuclear but not cytosolic Ca2þ negatively regulates TEAD. Fig. 4. Differential effects of nuclear and cytosolic Ca2þ on TEAD activation. CHO cells were transiently transfected with 0.5 lg pF101TK-Luc, plus 0.5 lg either vector, pGFP (control), pPV-NLS- GFP, pPV-NES-GFP, and pPV-NLS-CD-GFP, in addition to 0.5 lg pRSV-Gal. Cells were lysed 48 h after transfection and the luciferase and b-galactosidase activities were determined. Data are means SE from seven separate experiments, each performed in triplicate. Asterisk indicates a significant difference (p < 0:05) compared to GFP control. Fig. 5. Modulation of TEAD activity by distinct kinase pathways. CHO cells were transfected by electroporation with pF101TK-Luc and pRSV-bGal. Twenty-four hours after the drug treatment, cells were lysed and assayed for luciferase and galactosidase activities. RLU measurements were normalized to b-galactosidase activity and the results are presented as percentage of control (without treatment). (A) Role of MAPK pathway on TEAD activity. One day after transfec- tion, the cells were treated with 50 lM PD89059, a MAPK kinase in- hibitor. Data are means SE from four separate experiments, each performed in triplicate. Asterisk indicates a significant difference (p < 0:05) compared to GFP control. (B) Effect of protein kinase C (PKC) on TEAD activity. One day after transfection, the cells were treated with 200 nM PMA. Data are means SE from six separate experiments, each performed in triplicate. (C) Modulation of TEAD activity by cAMP. One day after transfection, the cells were treated with either 0:5 × 10—6 M 8Br-cAMP, 15 lM H-89, or H-89 plus 8-Br- cAMP. The protein kinase inhibitor was added 1 h before addition of 8-Br-cAMP. Data are means SE from six separate experiments, each performed in triplicate. Asterisk indicates a significant difference (p < 0:05) compared to GFP control. Modulation of TEAD activity by other signal transduc- tion pathways The mitogen-activated protein kinase (MAPK) is one of the most widely utilized signaling cascades in eukary- otic cells. MAPK is particularly important for cell growth and differentiation [27,28], processes that are also regu- lated by TEAD. Moreover, certain components of MAPK signaling are regulated by nuclear Ca2þ [17]. We therefore investigated if the MAPK signal transduction pathway modulates TEAD activity. The MAPK kinase inhibitor PD89059 increased TEAD activity 1:66 0:15 times above control (Fig. 5A), suggesting that MAPK activation downregulates TEAD activity. We also in- vestigated whether protein kinase C (PKC) and cAMP- dependent signaling pathways play any role in TEAD activation. The PKC activator PMA did not significantly alter the basal activity of TEAD in proliferating CHO cells (Fig. 5B). Addition of 0:5 10—6 M 8-Br-cAMP, a cAMP analog, decreased luciferase expression 4:13 2:11-fold relative to controls (Fig. 5C). The inhibitory effect of 8-Br-cAMP was absent at a concentration of 0:5 10—9 M (data not shown). Since regulation of gene transcription by cAMP is usually mediated by PKA ac- tivation, we tested the ability of the PKA inhibitor H-89 to reverse TEAD inhibition induced by cAMP. CHO cells were treated with 15 lM H-89 for 1 h before addition of 0:5 10—6 M cAMP. At the concentration used, H-89 was unable to alter the inhibitory effect of cAMP on TEAD activity. Discussion Intracellular Ca2þ and protein phosphorylation rep- resent signaling pathways that regulate a wide variety of biological processes in most cell types. One way that intracellular Ca2þ regulates multiple cell functions is through spatial separation of Ca2þ signaling patterns [29,30]. Localized subcellular increases in Ca2þ direct cellular functions such as secretion in pancreatic acinar cells [31] and cell motion in neuron growth cones [32,33]. The distinction between nuclear and cytoplasmic Ca2þ signals has only recently been investigated. Several re- ports have identified a separate function for nuclear Ca2þ [13,15,16]. For instance, nuclear Ca2þ plays a sig- nificant role in regulating CRE- and CBP-dependent gene transcription [14–17,26,34,35]. In this work, the role of spatial separation of Ca2þ signals and TEAD activation was investigated. We used a method that in- hibits nuclear versus cytosolic Ca2þ signals by selectively targeting expression of the Ca2þ chelator protein PV to the nucleus or cytosol. The effectiveness of targeted PV to prevent increases in nuclear versus cytosolic Ca2þ has already been demonstrated [17]. Our current data reveal the first example to our knowledge, of a novel role in which nuclear but not cytosolic Ca2þ regulates the TEAD family of transcription factors in proliferating cells. The data suggest that nuclear Ca2þ has a negative role in TEAD activation. It is possible that Ca2þ in the nucleus can activate nuclear kinases that lead to phosphorylation and inactivation of either TEAD or TEAD cofactors. Another possibility is that nuclear Ca2þ can directly interact with TEAD transcription factors and regulate their activity. It is relevant to note that there are transcriptional factors that are directly dependent upon Ca2þ. For example, a transcriptional repressor called DREAM (downstream regulatory element (DRE)- antagonist mediator) binds Ca2þ directly and mediates transcriptional repression of c-fos [35]. Since TEAD is primarily localized to the nucleus [10], this may explain why cytosolic Ca2þ appears to have no effect on TEAD activity. The MAPK enzymes are common and essential com- ponents of many signaling cascades, and are activated by growth factors and certain types of Ca2þ signals. When active MAPKs localize to the nucleus where they trans- activate, by phosphorylation, a variety of transcription factors [27]. We found that inhibition of MAPK increases TEAD activation. It is possible that MAPK pathways alter TEAD activity through phosphorylation of TEAD or TEAD cofactors. It is also possible that the observed modulation of TEAD activity be related to changes in TEAD expression levels. Another hypothesis is that Ca2þ and MAPK pathways converge in the nucleus to regulate TEAD transcription factors, since both signals downre- gulate TEAD activity. However, it is not clear how both Ca2þ and MAPKs could be integrated within the nucleus to alter the activation of TEAD. Contrary to our findings that MAPK pathways have an inhibitory effect on TEAD activation, many transcription factors that are phos- phorylated by MAPKs direct transcription activation of genes that are essential for the initiation of mitogenesis, differentiation, and apoptosis [27,36–38]. TEAD isoforms are phosphorylated in vivo [39], and based on sequence conservation, it has been suggested that they are targets of other intracellular signaling kinases besides MAPK, such as PKC and PKA [40]. We found that PKC did not affect TEAD activity in pro- liferating cells. We further found that cAMP inhibited basal TEAD activity. We could not abolish the cAMP inhibitory effect on TEAD activity with H-89, a widely used inhibitor of PKA phosphorylation in intact cells [41,42], suggesting a cAMP-dependent, PKA-indepen- dent process. In fact, several cAMP-binding proteins other than PKA have now been described, such as cyclic nucleotide-gated channels involved in transduction of visual signals [43], cAMP-activated guanine-nucleotide exchange factors, which activate specifically the monomeric G protein of the Ras family, Rap-1 and Ras, re- spectively [44], cAMP-mediating H-K-ATPase activity through ERK cascade [45], and others. Contrary to our findings it was shown that TEF-1 (TEAD-1) is a target of the cAMP-dependent signaling pathway, where PKA phosphorylates TEAD-1 and represses its DNA binding ability [46]. It is possible that PKA-dependent as well as PKA-independent mechanism could coexist and modu- late TEAD activity. Additionally, it has been shown that cAMP pathway and nuclear Ca2þ both activate CREB Binding Protein (CBP), which is critical for full CREB function, and regulation of numerous other transcrip- tion factors [14,15]. The actual mechanism mediating cAMP and nuclear Ca2þ regulation of CBP involves activation of CAM kinase II, CAM kinase V, and PKA [11,18,26]. Therefore, it is also possible that cAMP and nuclear Ca2þ interact to regulate TEAD activity. Together, our results show that nuclear Ca2þ and distinct kinase pathways inhibit the TEAD family of transcription factors. The exact mechanisms by which TED-347 transcription factors are regulated and the effect of these pathways on each TEAD isoform are questions that remain to be addressed.